Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSH464
Clone ID CSH464
Vector pGT0Lxf
Project baygenomics

Sequence tag CSH464
Sequence
AGAGCGGAGAATGGGAGTAGAGCAGAGTGTCTGAACAGCACGCTCACCCATCTCCTCTCCGCCTCGCTCTCCTGACCTGT
TCACCCATCCATCATCCGGCCGGCCACCGCTCTGAACACCTTCCACCATGGCCACCTCAGCAAGTTCCCACTTGAACAAA
GGCATCAAGCAAATGTACATGTCCCTGCCCCAGGGTGAGAAAGTCCAAGCCATGTATATCTGGGTTGATGGTACCGGAGA
AGGACTGCGCTGCAAGACCCGTACCCTGGACTGTGAGCCCGAAGTGTGTGGA
Sequence Type mRNA
Unitrap ID UNI6000

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 155747076..155750240 175
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026473 (Glul) NM_008131 glutamate-ammonia ligase (glutamine synthetase) Gene [Source:MGI (curated);Acc:Glul-001]

 
Come back to gene ENSMUSG00000026473


For any suggestions or comments, please send an email to unitrap@crg.es