Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST221108
Clone ID OST221108
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST221108
Sequence
GACTGAGCACCCCTCTCTACCTGCCAACATCCTGTATTAGAGGAGCTTGTGGCTGGAGGTGTGACCGCGGGAGAGCTGGC
CGGGGAGGGACCCTGCTCANTCGCTGCTCTGCTCCTGTCTCTTGTCCCCTCCCCCCGCCATGACAGAGACCCGTGAACCC
ACTGAGACTGGAGGCTACGCCAGCTTGGAGGAAGATGATGAAGACCTTTCCCCAGNCCCNGANCATTNTTANGACTNTGA
ATACACTCTTTCAGAGCCCGACTCTGNAGGAGGAGGAGGAGGCAA
Sequence Type mRNA
Unitrap ID UNI19205

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 25295563..25300121 208
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000064264 (Zfp428) NM_146183 zinc finger protein 428 Gene [Source:MGI Symbol;Acc:MGI:1916463]

 
Come back to gene ENSMUSG00000064264


For any suggestions or comments, please send an email to unitrap@crg.es