Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSH498
Clone ID CSH498
Vector pGT0Lxf
Project baygenomics

Sequence tag CSH498
Sequence
GATCCTGACGGTGCAGCAGCCCGCAGCCTCAGCCAGGGAGTACCAGCCGCTTTCAATGGAGGAGAAGACCGGCCAGCCAC
AGCCTCAGCACCATCACAGCCACCACCATCCGCACCATCATCCCCAGCAGCAGCAGCAGCAGCAGTCGCACCACCACCAC
CATTATTATTTCTACAACCACAGCCACAACCACCACCACCACCACCATCACCAGCAGCCTCACCAATACCTGCAGCATGG
AGCCGAGGGCAGCCCCAAGGCCCAGCCCAAGCCGGTGAAACATGAGCAGAAACACACCCTCCAGCAGCACCAGGAAACGC
CGAAGAAGAAAA
Sequence Type mRNA
Unitrap ID UNI5210

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77499675..77500006 326
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037857 (Nufip2) NM_001024205 nuclear fragile X mental retardation protein interacting protein 2 Gene [Source:MGI (curated);Acc:Nufip2-001]

 
Come back to gene ENSMUSG00000037857


For any suggestions or comments, please send an email to unitrap@crg.es