Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST220653
Clone ID OST220653
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST220653
Sequence
ATTTGTGGCACACCCTGGTGGCCGCAAACTTGGNGGCACACCCACCACTGGCCCTGGGTAAGCGAGCCTTCAGGATAGAA
GACTAGCTCGTGNGTTGGTNGGAAGCCCTCATTGANCGAAGCTGGGTGGNGNCTGCGGCTCACTGCATCCAGGGNAGCNA
GGAGTACTCAGTGATGTNGGGTAGCAGCACCCTCCACCCCAACGGCTCCTCCTGGACCCTGAAGATTCCCGTGGGTGACA
TCATTATTCATCCCAAGTACTGGGGCCGGAACTTCATCAGAAGCGACATTGCCCTTNTCTGCCTTGAAACCCCTGTCACT
TTNAACAAGTACGTGCAGCCCATNTGTCTCCCAGAGCACAACTTCAACTTCAAGGTCGGGACAAANTGCTGGGTGACTGG
CTGGGGCCAGGTTAAGCANCACTCCTCAGCCCAGTTGACACCGGCTCCAGAGCTTTGGGAAGCTGNGGTATTNATTATNG
ACAACAAGAATTGTGACAGCATTTTCCACAAGAAGACCTTGNATCCCCAAGTTGTCCCCCTTATCCGGAAGAACATGATC
TGTCCCACCATTTATAGGGNGNGACTTGCGCTTTGGAAACCCCGGGGGGGCCC
Sequence Type mRNA
Unitrap ID UNI24438

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110740925..110743055 258
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047257 (BC107230) NM_153172 Inactive testis serine protease 5 Precursor (Trypsin-like protease p98) [Source:UniProtKB/Swiss-Prot;Acc:Q8K4I7]

 
Come back to gene ENSMUSG00000047257


For any suggestions or comments, please send an email to unitrap@crg.es