Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSH516
Clone ID CSH516
Vector pGT0Lxf
Project baygenomics

Sequence tag CSH516
Sequence
ACGCGAGGCGAGGCCGGCCGGGGCCCCCGCAGCCATGGAGAACGCTCACACAAAGACCGTGGAGGAGGTGCTGGGCCACT
TCGGGGTCAACGAGAGCACGGGGCTGAGCTTGGAGCAGGTCAAGAAGCTCAAGGAGAGATGGGGCTCCAACGAATTGCCG
GCTGAAGAAGGAAAAACCTTGCTGGAACTTGTGATTGAGCAGTTTGAAGACTTACTAGTTAGAATTTTACTGCTGGCAGC
ATGTATATCTTTCGTTTTGGCTTGGTTCGAGGAAGGGGAAGAAACGATTACAGCCTTTGTAGAGCCGTTTGTAATTCTGC
TTATCTTGGTAGCCAATGCAATCGTGGGTGTGTGGCAGGAAAGAAATGTTGAAAATGCAATAGAAGCTCTTAAGGAATAT
GAGCCTGAAATGGGCAAAGTGTATCGACAGGACAGAAAGAGTGTGCAAAGAATTAAAGCTAAAGACATAGTTCCTGGTGA
TATAGTGGAAATTGCT
Sequence Type mRNA
Unitrap ID UNI1308

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 122939248..122951728 152
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029467 (Atp2a2) NP_001103610 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 Gene [Source:MGI Symbol;Acc:MGI:88110]

 
Come back to gene ENSMUSG00000029467


For any suggestions or comments, please send an email to unitrap@crg.es