Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSH524
Clone ID CSH524
Vector pGT0Lxf
Project baygenomics

Sequence tag CSH524
Sequence
GAGAAGCTCAGGCGGTGCAAGAGCGCGAGCGCGGGAGTTAGCGGTGCAGCCATGGTGGGACACCTGAGCGAGGGGGCCAT
CG
Sequence Type mRNA
Unitrap ID UNI2899

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 75161730..75161811 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000751 (Rpa1) NM_026653 replication protein A1 Gene [Source:MGI (curated);Acc:Rpa1-001]

 
Come back to gene ENSMUSG00000000751


For any suggestions or comments, please send an email to unitrap@crg.es