Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST220542
Clone ID OST220542
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST220542
Sequence
ATGGCCAACTCTAGTTCTCAACACATGGTCTGTGGGTCAGTGACATTTAGGGATGTGGCTGTTGACTTCTCTCAGGGAGG
GAGTGGGCCTGCCTGGATGCTACTCAGAAGGTCTTATACAGGAACATAATGTTGGAGACCTACAGCAACCTGGTCGCAGT
GGTGGGACGTTGCATTCCCAAGCCAGATCTGATCGTCTTACTAGAGCAGGGAGAAAGAGCCCTGGATGGCTGTGAAGAAA
GAAACAGGCAGGCCGAGCCAAGGTTTGGAGACAGGTTTTGAAGCTGAAAATAGATCTCCAAAGAATCATGTTTATAATAA
AAAGTTACCCAAACAAACCATACAGNAATTANGTTAAACTTCGGACGTCCAGGGCGTCAGTGTTAGTAATGGCCCTGGCT
NTAGTGTAATCAAGGAGCCACAGAATTATCAAGAAGGAGATGCTAATCGAAATATTACTAACAAGAAAGAAATGTCTACT
TACACTAGCAAGACTNTTGCTCACAATAAAGAAAAACCGTATTAATGTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI15802

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28521975..28533455 259
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037640 (Zfp60) NM_009560 zinc finger protein 60 Gene [Source:MGI (curated);Acc:Zfp60-001]

 
Come back to gene ENSMUSG00000037640


For any suggestions or comments, please send an email to unitrap@crg.es