Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSH530
Clone ID CSH530
Vector pGT0Lxf
Project baygenomics

Sequence tag CSH530
Sequence
TTGATATGATCTTCATCGTCAAAGATGAGCACAATGAGGAGAGGGACATGATGCTAGCCAAACATGTGATGACTCTGCAT
GTGAGTGCACTGACACAGACACAGGCCTGTGGAGGGTGAGATCGACCTGGCCAAGATGAAGAAGTTCA
Sequence Type mRNA
Unitrap ID UNI6014

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 77645564..77646987 95
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005410 (Mcm5) NM_008566 minichromosome maintenance deficient 5, cell division cycle 46 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:103197]

 
Come back to gene ENSMUSG00000005410


For any suggestions or comments, please send an email to unitrap@crg.es