Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST220353
Clone ID OST220353
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST220353
Sequence
ATTCTTATTGGTGCTCTTGCTGCACTGGTTGATNATGCNAGCAGATGCTGATGCTACCAGAATAGACATTTATGCTGAGG
AGCGGGAGGACCTTCGAGGAGGATTTATGCTTTGCTTTTTGGATGATGGAGCAGGAATGGATCCAAGTGATGCTGCTAGT
GTGATCCAGTTTGGGAAGTCAGCCAAAAGAACTCCTGAGTCCACTCAAATTGGGCAGTATGGCAATGGATTAAAATCGGG
CTCAATGCGGATTGGGAAGGATTTTATCCTTTTCACTAAGAAGGAAGATACCATGACCTGCCTCTTCTTGTCTCGCACCT
TTCATGAGGAANAAGGCATTGATGAANAAATTNTCCCNTTGCCCACCTNGAATGCTCNAACACGNTAACCNTTCACNGAC
AATGNNGAAGAANTTTGNCCTTGANACANAANNNGTCNACNANAACTTCNNNCTTCCACACTGAGNAGCAAGTGAGGAAC
CAGNTNGTGAANATTNCTGGAAATANTGNAACACTGNNGATCATCTTTAATCNTAAGCTCATGGATACTGGANAANCCAN
NNNCNTTGTGTTGNNACACCAANGAANATNGNNCCTGNGAGANCCGNCNCCGGGAGCCTTCCCTTTCCCCTTCCAGCCCG
GTTATCAT
Sequence Type mRNA
Unitrap ID UNI9221

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3558687..3576150 107
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034543 (Morc2a) NP_937805 microrchidia 2A Gene [Source:MGI (curated);Acc:Morc2a-001]

 
Come back to gene ENSMUSG00000034543


For any suggestions or comments, please send an email to unitrap@crg.es