Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST220291
Clone ID OST220291
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST220291
Sequence
AAACACTGGGCTTGACTCTNAAAGCGGTGCTACCGAGAGATGGTCATGTTACTTGTCTTCATCTGTGTTGCCATGGCAAT
CTTTAGTGCACTCTCTCAGCTCCTTGAACATGGGCTGGACCTGGAAACATCCAACAAGGATTTCGCCAGCATCCCCGCTG
CCTGCTGGTGGGTGATTATCTCTATGACTACAGNTGGCTATGGAGATATGTATCCTATCACGGNGCCCTGGAAAAAAAAA
AA
Sequence Type mRNA
Unitrap ID UNI17266

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 83987223..83987454 212
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045053 (Kcng3) NM_153512 potassium voltage-gated channel, subfamily G, member 3 Gene [Source:MGI Symbol;Acc:MGI:2663923]

 
Come back to gene ENSMUSG00000045053


For any suggestions or comments, please send an email to unitrap@crg.es