Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YHD008
Clone ID YHD008
Vector pGT0Lxf
Project baygenomics

Sequence tag YHD008
Sequence
GATGATTGGGATTGATGGCTCAGAAGCAGCAGATGGATCTGACTGGTTCTGTTATCATGCAACCTCTCCTTCCATTTTCC
CTGTGGGTTTCTGTGAAATTAACATGATAGAACTGACTCCACCCAGAGGTTACACAAAACTTCCTTTTAAATGGTTTGAC
TACCTCAGGGAAACCGGCTCCATTGCAGCACCAGTAAAACTATTTAATAAGGATGTTCCAAACCACGGATTCCGTGTAGG
AATGAAATTAGAAGCTGTAGATCTCATGGAGCCACGGTTAATATGTGTAGCCACAGTTACTCGAATTATTCACCGTCTCT
TGAGGATACATTTTGATGGTTGGGAAG
Sequence Type mRNA
Unitrap ID UNI6030

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 93790948..93793669 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059474 (Mbtd1) NP_598773 mbt domain containing 1 Gene [Source:MGI (curated);Acc:Mbtd1-009]

 
Come back to gene ENSMUSG00000059474


For any suggestions or comments, please send an email to unitrap@crg.es