Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST219366
Clone ID OST219366
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST219366
Sequence
CCCGGGCAAGCACCCCGGTGCAGCCTTCTTCAGGTAGTATGGGACCANCACTNGGGAAAGCACGCCCGTGTNCGANCTTN
TCAAAGCCGAGGGCCAAGCCCATCAACCTAATTTCACCTTTCGGGTCACCGTTGGCGACACCAGCTGNACTGGTCAGGGC
CCCAGCAAGAAGGCANCCAANCACAAGGCANCTGAGGTGGCCCTCAAACACCTCAAAGGGGGGAGCNTGCTGGAACCAGC
CCTGGAGGACAGCAGTTNTTTTTCTCTCCTAGACTCTTCACCGCCTGAGGACACTCCTGTCGTTGCTGCAGAAGCTGNTG
CCCCTGTTCCATCTGCTGTACTAACCANGAGCCCTCCCATGGAGATGCAGCCCCCTGTCTCTCCTCAGCAGTCTGAGTGC
AACCCCGTCGGTGCTCTGCAGGAGCTGGTGGTGCAAAAAGGCTGGCGTTTGCCAAAAGTACATGGNGACCCAAGAGTCTG
GGCCTGCTCACCGCAAAGAGTTCACCATGA
Sequence Type mRNA
Unitrap ID UNI24460

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 102349577..102352499 116
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023051 (Tarbp2) NM_009319 TAR (HIV) RNA binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:103027]

 
Come back to gene ENSMUSG00000023051


For any suggestions or comments, please send an email to unitrap@crg.es