Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YHD044
Clone ID YHD044
Vector pGT0Lxf
Project baygenomics

Sequence tag YHD044
Sequence
GTTTACCAAACCATCAACACAGACAACAAACACAACAACACAGAAGGTTATTATAGTGACCACATCACCAAGTTCAACCT
TTGTGCCCAACATTCTCTCCAAATCTCATAACTATGCAGCAGTCACTAAGCTTGTACCAACATCAGTCATTGCCTCCACG
ACTCAGAAGCCACCTGTTGTTATAACTGCGTCCCAGGCCTCTCTGGTCACCAGTAGCAGCAATGGCAACAGCAGTTCTAC
GTCATCACCTATTTCTAGTACAGTTGCAGTAACAACGGTGGTATCTTCCACACCGTCCGTGGTCATGTCAACAGTAGCAC
AAGGTGTATCCACATCAGCAATCAAAGTGGCATCGACAAGACTTCCTTCCCCCAAAAGCTTAGTGAGTGGCCCTACCCAG
ATTCTTGCACAGTTTCCTAAACAGCATCAGCAGTCTCCTAAGCAGCAGTTACAGCAAGTACAACAACAGACACAGCAGCC
AGTGGCCCAGCCTTATTCAGTGTCTCAGCAGCAGCAGCCTCAGCAGTCAGCAATTGCCGCCTGGTA
Sequence Type mRNA
Unitrap ID UNI6041

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 105775009..105785816 282
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035401 (2210018M11Rik) NM_172280 RIKEN cDNA 2210018M11 gene Gene [Source:MGI Symbol;Acc:MGI:1924203]

 
Come back to gene ENSMUSG00000035401


For any suggestions or comments, please send an email to unitrap@crg.es