Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YHD056
Clone ID YHD056
Vector pGT0Lxf
Project baygenomics

Sequence tag YHD056
Sequence
TTTTGGCCACGTGACCGGAGCCAACATGGCGGCGCCCATCGGCGTCCCCCTGCTCGTCCGTGG
Sequence Type mRNA
Unitrap ID UNI5160

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 71291393..71291453 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041921 (Metapl1) NM_025633 methionine aminopeptidase-like 1 Gene [Source:MGI (curated);Acc:Metapl1-001]

 
Come back to gene ENSMUSG00000041921


For any suggestions or comments, please send an email to unitrap@crg.es