Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST218957
Clone ID OST218957
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST218957
Sequence
GACTGAGGATTATGCTAAAGAGAGATATGGGATATCTTCTATGATACAATCACAAGAAAAACCAGATAGAGTTTTGGTTC
GAGTTAAGGACCTGACAGTTCAAAAAGCTGATGATGTTGTTTGGGTCCGTGCAAGAGTTCATACAAGCAGAGCAAAAGGG
AAGCAGCGCTTTCTTANNCCTGAGGCANCAGCANTTTAATGTNCAGGCTCTTGTGGCGGTGGGAGACCATGCAAGCAAGC
AGATGGTTAAATTTGCAGCCAAGTAAGTAAGCAATTATATNCTGTTGTCAGAATAAACAATGGGGGGAACCAAGACTANN
AGGGGNAGGGNCCATTTTCATACTTTANCATNAGATGCTTCGNTAGTTTAAAAAAGGTAATCNTTGAAATNGCCNGTCCA
GCGTTGCTTGAATTAC
Sequence Type mRNA
Unitrap ID UNI20998

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 130301794..130311990 183
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026356 (Dars) NM_145507 aspartyl-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:2442544]

 
Come back to gene ENSMUSG00000026356


For any suggestions or comments, please send an email to unitrap@crg.es