Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST218411
Clone ID OST218411
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST218411
Sequence
GGGAATCAGGGGGCCCTCCCCCTTNCTTCATAACTANAGNTNTANCANCTAGGAANATGAGCCTTGTNACTANGTNCCNG
AACTNAAANGNTGAACGTATGCAAAGTTCCCGTAAGAAAAGAACCAGCTCCTACAGGGATTATGATGTTCCATTTTCTCA
GAATTCAGCCATCACAGNGGTTCATCTCCAGAATCTTATCCACCTGACACAGAAACTCTGTACCTCAGAGGCAGACCTGC
TCCGCAGCCCTCTGACTGCTGTCCTCACTTTCTGTCTATGAACTCCAGGGCCCTCGGATCACACGCTGTTTTTCCTTTTG
GATATGGCTGNGTTACTTACCATGTTTTCAGGATTCATTCATGTTGCAGACTAAATTAAAATTTCNTTCTTTTTAAGACT
AAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI24480

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 128818933..128819356 236
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042851 (Zc3h6) NP_848491 zinc finger CCCH type containing 6 Gene [Source:MGI (curated);Acc:Zc3h6-001]

 
Come back to gene ENSMUSG00000042851


For any suggestions or comments, please send an email to unitrap@crg.es