Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST218037
Clone ID OST218037
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST218037
Sequence
AAAATTTGAAGCTGAAAACATCTCCAACTACACGGCCCTTCTGCTGAGCCAGGATGGCAAGACGCTGTATGTGGGGGCCC
GAGNAGGCCCTCTTTGCACTTAACAGCAACCTCAGCTTCTTGCCAGGCGGGGAGTACCAAGAGCTGCTGTGGAGTGCAGA
TGCTGACAGGAAGCAGCAGTGCAGCTTCAAGGGCAAGGACCCAAAGGTGAGACTGAGGGATCTGGGCAGAACACTGAGCA
GATATGGCTGTTATGGGAAGGACACAGTCTGGACATCGCCAGCACTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNTGTCCTCTATGTGATCCTGGATAAATAGATTCATCTGGTCACCCCTTGGTTTTCTCACCTGTAAGATGGGAATAGTAT
GCCTATATCCCTGGATAAACCAGTGCATCCAGGGCTCCTGTCCCATTAGCGTTAGCACCAACATGAACTTGGTGAGGTGG
TGACAGTGTCTGTAAAGGGTCTNTAGTGGACAGATAAGTCTGGCAGATTCTAGTTTGATTTCAGCCAANACATTANATGG
TATCCAGCCCAGTCCANAGTTCTCTTGTAGGACTTGCCTGCCATTCTCAGAGGCCTCCCCNTCCATACACGCTTTANTNT
GGAAACAGTCAGNAAGTACTTGTTGGCAGTGA
Sequence Type mRNA
Unitrap ID UNI24496

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 87357704..87358674 323
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030539 (Sema4b) NM_013659 sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B Gene [Source:MGI (curated);Acc:Sema4b-001]

 
Come back to gene ENSMUSG00000030539


For any suggestions or comments, please send an email to unitrap@crg.es