Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YHD140
Clone ID YHD140
Vector pGT0Lxf
Project baygenomics

Sequence tag YHD140
Sequence
ACTTAACCGTGAGGGTGCTGAAACTTTTGCTGACCACCGGGAGGGTATCTTAAAGACAGCAAAGGTTCTTGTGGAGGACA
CCAAGGTCCTAGTGCAGAATGCAGCTGGGAGCCAGGAGAAGTTGGCACAAGCCGCCCAGTCCTCCGTGGCCACCATTACC
CGCCTCGCTGATGTGGTCAAGCTCGGTGCAGCCAGCCTAGGAGCCGAAGACCCTGAAACTCAGGTGGTGCTGATCAATGC
AGTAAAGGACGTAGCCAAGGCCCTGGGTGACCTCATCAGCGCTACGAAGGCTGCAGCGGGCAAAGTTGGGGATGACCCTG
CAGTGTGGCAGCTCAAGAACTCTGCCAAGGTGATGGTGACCAATGTGACATCATTGCTCAAGACAGTGAAGGCTGTGGAA
GATGAGGCCACCAAAGGCACACGGGCCCTAGAGGCAACCACAGAGCACATACGTCAGGAACTGGCGGTCTTCTGTTCCCC
AGAGCCACCTGCCAAGACCTTTACCCCTGAAGACTTCATCCGAATGACCAAG
Sequence Type mRNA
Unitrap ID UNI6068

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 43547572..43549154 188
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028465 (Tln1) NM_011602 talin 1 Gene [Source:MGI (curated);Acc:Tln1-001]

 
Come back to gene ENSMUSG00000028465


For any suggestions or comments, please send an email to unitrap@crg.es