Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST217610
Clone ID OST217610
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST217610
Sequence
CACGGACAGGGACGCNCAGAANGATGCTGCANCAGANCATGACGCGCGNCGNNNNTTCGGNNCCACACCGATTGCAGAAN
NTGNTNCGNCNGCNGAGNCNATNTNTGAACAGTCNTCANCAGACAACNCACAAGAGGATGGGGAGAGTGTCTAACTTCTC
CGTTAGGAACACTCAAGAAGGAAATAAATTCAAGAGGAAAGACTATTCTTCCCAGATAGCAGAAGGAGAACAAGATTCAA
ATTTAAGAGAGAGAAGAATGAACGTGTCAAAGAATGATGCAAATACCAATTCTGCCTTCTGGGACTCTCTTCATTTGGAT
GATGCAACGAAGGAAAGTTCACACAGAAGGGAGAGCGCCTCCGCGTGGAATAAGAAGAAATTGCCGGCCGCCACACAAGT
CACCAGGAAGAAATGGACAGAAGCAATGCCTCCAAAACTCCGCCTACACCTTCTGAACGAAGAGCTGGGAGAACTCAGCC
TGAAATGCCGGGAGATTGAACGGGACTTTGAAAACGCCGAAAAAGAACTTTTGAACTTTAGAAAGGAAGCCTCCGTGAAA
GCTGTCAATTTTCAAGAACCAGGGACAGGTGCTTCCAAGAAAGACCGGGAACTGCAAGCTTTAAAAACGACCTGTCTGAA
AAGCGACAACGTAAAAACTTAACTGAA
Sequence Type mRNA
Unitrap ID UNI16635

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 50151358..50151922 542
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073207 (6330534C20Rik) NM_001034059 RIKEN cDNA 6330534C20 gene Gene [Source:MGI Symbol;Acc:MGI:3588225]

 
Come back to gene ENSMUSG00000073207


For any suggestions or comments, please send an email to unitrap@crg.es