Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST217584
Clone ID OST217584
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST217584
Sequence
AACAGTTTCACTCAGGNACCCTCACCGGTGGNATCATGATTCCTTGGNAGTCCAAGCGCCCACGCCTGGAGCCAGTTTCT
GATGCCCATTTCCAGCGTGTTAGTGCTGCGGTTTTACCTTTAGTTCACTCGCTGCCAGAAGGCTTGAGGTCGTCTGCAGA
TGCTAAGAAGGATTCAGCATTTGGAAGCAAACATGAAGCTCCATCCTCTCCTTTGGCTGGGCAACCATGTGGAGATGACC
AAAATGCTTCACCTTCAAAGCTTTCAAAGGAGGAGTTAATACAGAGTATGGACCGGGTAGACCGAGAGATTGCAAAAGTA
GAGCAGCAGATCCTTAAATTGAAAAAGAAACAACAACAGCTAGAAGAAGAAGCAGCTAAGCCCCCTGAACCAGAGAAGCC
TGTGTCCCCTCCTCCTGTGGAACAAAAACACCGTAGTATTGTCCAAATTATTTATGATGAGAATCGGAAAAAAGCAGAAG
AAGCTCATAAAATATTTGAAGGTCTTGGCCCAAAAGTTGAACTGCCACTTCTATAACCAGCCATCANATACCAAGGGNGT
ACCATGAGAACATTAANGACTGGAGTTCCTGCAAGGCNCATGAATGAAAAACCAGGTG
Sequence Type mRNA
Unitrap ID UNI2063

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62217304..62236543 186
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018501 (Ncor1) NP_035438 nuclear receptor co-repressor 1 Gene [Source:MGI (curated);Acc:Ncor1-001]

 
Come back to gene ENSMUSG00000018501


For any suggestions or comments, please send an email to unitrap@crg.es