Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST217519
Clone ID OST217519
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST217519
Sequence
GACTGAGGAGGGTGTGAAGCACNGGGTAATGACCNNATGCAACCTGNATGTGNNCTTGCNGGATGGCTTCTGNNGGNACA
GANNAAGACNCATGAGGNNCACCCCNNTGAGCAAGCTGATGAAGGCCTACTGTGAGAGGCANGGCCTTGTCAATGAGGCA
GATTCGATTCCGGTTTGATGGACAACCAATCAATGAAACAGACACTCCAGCCCAGCTGGAGATGGAGGATGAGGACACCA
TTGATGTATTCCAGCAGCAGACAGGAGGATCAGCCTCCCGAGGGAGCGTCCCCACACCCAACCGTTGTCCTGACCTGTGC
TATTGAGCAGTGACCATGCAGCCACACCCAATCACACAAGAGTCAGCAGAAGCCAGAGTCACCGAAGGATTCTCCTTTTC
CGACGCGCTTGGAGTGAACTACACATAGACCACACTGCGGGGCGAGAGCATTACATAACATGGCCACTAGGAGGGTTTGG
TTTTGGGGGGAAATGAAGGTGTT
Sequence Type mRNA
Unitrap ID UNI4781

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 77072555..77079176 277
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020265 (Sumo3) NM_019929 SMT3 suppressor of mif two 3 homolog 3 (yeast) Gene [Source:MGI (curated);Acc:Sumo3-001]

 
Come back to gene ENSMUSG00000020265


For any suggestions or comments, please send an email to unitrap@crg.es