Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST217089
Clone ID OST217089
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST217089
Sequence
CCCAATTTGTTGTCAATGTACAAGAAATTGGCCTGGCCCCCGTGTTGGGCTACCTGATTCTTGAAGGAAGACTTTAATGT
TGCACTAGGTGTTTTTGCTTTAGCCGGGCTAACGGATTTGTTGGATGGATTTATTGCTCGAAACTGGGCCAACCAAAAAT
CAGCTTTGGGAAGTGCTCTTGATCCACTTGCTGATAAAGTTCTTATCAGCATCTTATATATTAGCTTGACCTATGCAGAT
CTTATTCCAGTCCCACTCACTTACATGATAATTTCAAGAGATGTAATGTTGATCGCTGCTGTGTTTTATGTCAAATACCG
AACTCTGCCAACACCGCNAACACTAGCTAANTACTTCAATCCTTGCTATGCCACGGNTAGGTTAAAACCAACATTCATCA
GCANGGTAAATACAGCAGTCCAGTTAATTTTGGNGGCAGCTTTCTTTGGCAGCTNTAGTTTTTCAATTATGCTGACAG
Sequence Type mRNA
Unitrap ID UNI24509

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 132675623..132689896 131
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027357 (Crls1) NM_001024385 cardiolipin synthase 1 Gene [Source:MGI (curated);Acc:Crls1-001]

 
Come back to gene ENSMUSG00000027357


For any suggestions or comments, please send an email to unitrap@crg.es