Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone BC0208
Clone ID BC0208
Vector pGT2lxr
Project sanger

Sequence tag BC0208
Sequence
TTCGGGGCATGAGCTGAGGGCACAGCTCTGAGGCTAGCAGTATTTCTCAGAGATTGATGGAAACAGAAACCAAAACTCTT
CTCCTGGAGAATGCATCCATCCTTTCAGAGGGCTCTCTACAAGAAGGACACCGATTATGGATTGGCTACCTGGATCCCAA
AAGCACAGAATACCACCTCGTCCAGCTGGTCGAGAGAGGGGGCATTGGTGTAGTTGTCGGTCATCATCCCATCCTACCCT
CTCTCCTTGCCAGATTTGTTCTTCCGGTCTTCGTCCCGTGATACTTTTTTCTCCGTCCCCGTTCACTCTCTTTATCCCTC
GTTCTTGCTCCTTCCTCCCGTTCATTATTCCGTTTTCTTTATCTATGGATACATCATCTACTCTCCTCGTGATGTTCTTT
CTATGTGACTCTATCTTCTTTTTATTTCCCTCCTCTCCTTTTTTATGTCTAGATCATCGCTAGTCTAACCTCAG
Sequence Type mRNA
Unitrap ID UNI554

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 35175071..35992041 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026889 (Rbm18) NM_026434 RNA binding motif protein 18 Gene [Source:MGI (curated);Acc:Rbm18-001]

 
Come back to gene ENSMUSG00000026889


For any suggestions or comments, please send an email to unitrap@crg.es