Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST216825
Clone ID OST216825
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST216825
Sequence
TGTGGGTGGTGCTAAGCGAAGAACCANGGACATGAGACCCCACCGGCTTCCTANTCANGGCGANNGCGNCCTGCNANNGG
AACCGGAATNNNTGTGTTCTATAAATGAANCCANANGTGGCAAGTATGTCCCTCGAGCTATCTTGGTGGATCTAGAACCT
GGGACTATGGACTCCGTTCGCTCAGGTCCTTTTGGCCAGATCTTCAGACCAGACAACTTCGTTTTCGGTCAGTCTGGGGC
AGGCAACAACTGGGCTAAAGGCCACTACACAGAGGGAGCTGAGTTGGTTGACTCTGTCTTGGATGTGGTGCGGAAGGAGG
CGGAGAGCTGTGATTGCCTGCAAGGCTTTCAGCTGACCCACTCACTGGGTGGAGGCACTGGCTCTGGCATGGGCACCCTG
CTCATCAGCAAGATCCGGGAAGAATATCCTGACCGTATCATGAATACCTTCAGTGTGGTGCCCTCGCCCAAAGTGTCTGA
TACCGTGGTCGAGCCCTACAATGCCACCCTGTCTGTCCATCAGTTGGTTGAGAACACGGATGAGACCTACTGCATNGACA
ACGAGGCCCTNTACGACATCTGNTTCCGTACCCTTAAGCTCACCAGGCCACCTACGGAGACCTGACCATNTTCGTTTTGG
CCACCATGAGCGGGNGTNACCNNCTGCCTCCGNTTTCCCGGGCCAGCTTAATGCTGACCCTT
Sequence Type mRNA
Unitrap ID UNI24520

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35972514..35973218 432
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001525 (Tubb5) NM_011655 tubulin, beta 5 Gene [Source:MGI (curated);Acc:Tubb5-001]

 
Come back to gene ENSMUSG00000001525


For any suggestions or comments, please send an email to unitrap@crg.es