Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST216643
Clone ID OST216643
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST216643
Sequence
ATTGCCTGTCCCCAGCCATTAGCCTGNTGAAACAGGGNAAGTCGCCCTCTCAGGAAACTGATTTGAGCACCCCGCAGACT
CCCTTCCATGATGCTCTCAGCCACCATGGTAAACACCGGAAGCCTTCTGTCTGCCAAGCCCTGACCTGGGCGCTAGGGAG
ACTGATGAATTGATCGGACATGACATTCACACTCCAGTAGGCTGGGAGAGCATACCTGAGGAACTTAACACAGTCTGCAG
ACTTACTGGAGACGGTCTCATGTAGTCTAGGCTAGCTATGGACTTGCTTTGTAGGTACAGATAGGCTTGATTTTCCCCCA
TTTTTGAGACATGGTCTCTCTATGTAACCCTTGGCTCTCCTGGAATTCTCTGTGGACTAGGCTGGTTTTGAATTTACAGA
AATCCACCTGCCTCTCTGCCTCTCTGGTGCTGAGATTAAAGGTGTGCACCACCATAAAAAA
Sequence Type mRNA
Unitrap ID UNI17296

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4984378..4984828 421
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074405 (6430526N21Rik) NM_001033383 RIKEN cDNA 6430526N21 gene Gene [Source:MGI Symbol;Acc:MGI:2442656]

 
Come back to gene ENSMUSG00000074405


For any suggestions or comments, please send an email to unitrap@crg.es