Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YHD247
Clone ID YHD247
Vector pGT0Lxf
Project baygenomics

Sequence tag YHD247
Sequence
AATGAGGAAGCTTTCATAAGTGACAAGGAATTGATTTCAGATAACGAGGAAATGGCAACTTGCCTAGAAGAGGATAATGA
CCAAGAAGAGGATAGTATAATCCCAGATT
Sequence Type mRNA
Unitrap ID UNI6104

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 101384642..101384750 107
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017146 (Brca1) NM_009764 breast cancer 1 Gene [Source:MGI (curated);Acc:Brca1-001]

 
Come back to gene ENSMUSG00000017146


For any suggestions or comments, please send an email to unitrap@crg.es