Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST216250
Clone ID OST216250
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST216250
Sequence
AGTGTCTCAGTGGCTGGNAACACAATGGAATCACACAGGNACCCATAGTACACAGAGGTAAGTAGCTGGGGCCTCTAGCC
CATCTTGCACCAAGTCCTCAAAGTGAGTCTGTGGCTCACGAATTCCAGGAACTGTCTCTACAGTCCAGCCAGCACTTACC
CACTCTGAACGAACGGAAAAATGGACATAATAAGAAAAGCNAGAAGCNTNATTTGCCNCTAGTCTTGGGTTCCTGCAGGC
TGCATTTANANCCTGCCAGGTGTTTGGATGGTTGACAAGCTGCAGACTGGGAAGTTGATAGCNTCAAANTTAGANCNCTA
CCTGGAATANACGCCTNCTCCTGACAGGGCAACTGTGCTGCTTGCTGACTGTGCAGCTTGCCCAGCCTCTCATGGAATAC
TGCACTTAAAAACAGTCNGTCCACATCTCTCATGGNGTTGAAAAATTGGCACTTCGAGGATAGAANTAAAGATACTTTTC
TTTTTACATT
Sequence Type mRNA
Unitrap ID UNI24534

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 13326489..13333017 272
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079844 (Mkl2) NM_181860 MKL/myocardin-like 2 Gene [Source:MGI (curated);Acc:Mkl2-004]

 
Come back to gene ENSMUSG00000079844


For any suggestions or comments, please send an email to unitrap@crg.es