Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST216225
Clone ID OST216225
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST216225
Sequence
AGGTACGTGTGTGCTCAGTGCCCCCGGTGCGGGNACCCTCACATGTCAACTTTCCTCCAGCAAACTTCGGGTGGCAATGG
CCCACTGCCTCGANAAGCACCTCGTACCGAAACACTGAGAACCTGTGTTCTTGCAAACCTTAATGGTTCTAAGGAAGCGA
CGCTGCCCCCTGGCGTCCTAGGCCGACTGTGTCTGAAGGAACTGGTAGAACAGAGAGGCACTGCTGGCTATGACCCCAGC
ATAGACCACTGTTTGGTGACTGAAGATGTGCTCTCTGTGCTCTCGGAGCTGCAGGAGGCTGTGCGCCACTGGCCAGAGGG
CGGCCACCCAGGCCCGGCTGGGCGTCCAGATGCTGGNGTANATGACTGNGTGGTTATACACGTGGTTAGCTGTGAAGAGG
CATTCCAGCAACAAAAGCTGGATTTGCTNTGGCAAAAATTGGANGACCGGGCTCCTCACAAGCAGAAACACCTGGGGNGN
GGNCCCGAGAAAAATGGNTGGNGTACCCGGNCCCAGCTGACTGCCCCTTANNACTACAGGCTCAGACATGCTCANGNGGG
GCGAGGCCCCAACTTT
Sequence Type mRNA
Unitrap ID UNI24535

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108472895..108473851 235
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019039 (Dalrd3) NM_026378 DALR anticodon binding domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1915039]

 
Come back to gene ENSMUSG00000019039


For any suggestions or comments, please send an email to unitrap@crg.es