Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST216133
Clone ID OST216133
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST216133
Sequence
AACCAATTCTACGAGNACACCAGTCATCAAGCAAGNAAAATGAGTCAAGCTATGATAGGAGACCACTAGNACATGGAGCC
ACAGCAGCAAGTATATCACCCAGAATTGAAGACAGAAATGAAGCAAGGAAGCCCCACCCAGCTTNCTCCCCCCTGAAGCC
TCACAGCTCAAGACAGACAGACCACAATTCCAGAATCGAANGAGGCCCTTTGAAGAGAATCGAGGCCGNGGGTACTTCGA
GCACCGAGAGGATCGAAGGGGCCGCTCTCCTCAGCCTCCTGCTGAANAGGATGAAGATGACTTTGATGATACACTTGNGG
CCATTGACACATATAACTGTGACCTGCACTTCAAAGTGGCCCGAGANCGGNGATAGTGGCTATCCATTGGCGATTGGAGG
GCTTTGCATACCTTGTGGGTCAGGAGCCCGTGCCAGCTNTGGGGTCANAAGAAGGGCGTGTGGGTTTTGAAATGAAGATN
NAATGAGGGAAATCTTCGTGAAGCAANTTTCCATNTTACAGGACCCCGANCCCCNCCNTTGNCCGTATTGGGGTGGTCCT
TTGGACTNTTTGGAGCNCTTNAGCTTAGGTAGAGANTTGNNNNNCCAGGGAGNTCTNNACTNAAAAAGGGGGAGNCCCCT
TGGCTTCTAGGATT
Sequence Type mRNA
Unitrap ID UNI20107

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 26530112..26535983 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040725 (Hnrnpul1) NM_178089 heterogeneous nuclear ribonucleoprotein U-like 1 Gene [Source:MGI Symbol;Acc:MGI:2443517]

 
Come back to gene ENSMUSG00000040725


For any suggestions or comments, please send an email to unitrap@crg.es