Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST216004
Clone ID OST216004
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST216004
Sequence
GACTGAGATCCTCCCAAGGCACATGTGACCCATCACCCCAGACCTGAAGGTGAAGTCACCCTGAGGTGCTGGGCCCTGGG
CTTCTACCCTGCTAACATCATCCTGACCTGGCAGTGGGATGAGGAAGACCTGACTCAGGACATGGACCTCATTGAGACCA
GACCTGCAGGGGATGGGACCTTCCAGAAGTGGGCATCTGTGGTGGTACCTTCTGGAGAGGAACAGAGATACACATGTCAT
GTGCAACATGAGGGGCTAACCCAGCCCCTTGTTCTAAAATGGGACCCTTCTAAGCACACCATTCCCATCATGGGAATCAC
TGTTGGCCTGCTTCTCTTTGGAGTTGTGTTTACTGNANCTGTGGTTGCCATATTGATGAGGAAAAGGAAAGGGTCTCACA
CTGTACCCCTANACTGGGCTGGAACTCACTG
Sequence Type mRNA
Unitrap ID UNI9935

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 37122009..37124880 279
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024459 (D130003B22Rik) NP_001108547 histocompatibility 2, M region locus 6, pseudogene Pseudogene [Source:MGI Symbol;Acc:MGI:95918]

 
Come back to gene ENSMUSG00000024459


For any suggestions or comments, please send an email to unitrap@crg.es