Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST215823
Clone ID OST215823
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST215823
Sequence
GACTGAGGCATGGATGGGCAGAAGCCTTTGCNGGTNTCAAANGTCCCCACNTCAANTACNTCTGTCCACCTGCCCCTGTG
CNGCCAGTCACCTTAAATCTGNCTCTGGCTATGCCTTCTNGNATTGATATCGNTGGACTTTCACCAGATTCCCAGGAAGA
TGAATCTGGAATTAAACAGGCAGCAGAAACCGTAAAAGCCTTGATAGATCAAGAAGTGAAGAATGGCATTCCTTCTAACA
GGATTATTTTGGGAGGATTTTCTCAGGGAGGCGCCTTGNCTTTATACACTGCTCTNACCACACAGCAGAAACTGGCTGGT
GNCACTGCACTCAGTTGCTGGCTTCCACTTCGGGCTTNGTTTTCACAGGGGCCGATCAACAGNGCTAATCGAGATATTTC
CCGTTCTCCAGTGCCATGGAGATTGNGACCCTTTAGTTCCCCTAATGTTTGGGTTCTCTTACTGGTGAAAGACTAAAAGC
ATTGATAAATCCAGCCAANGTAACCCTTCAAAATCTATGAAGGCATGATGCCCAGCT
Sequence Type mRNA
Unitrap ID UNI20172

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4818663..4831202 150
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025903 (Lypla1) NM_008866 lysophospholipase 1 Gene [Source:MGI (curated);Acc:Lypla1-001]

 
Come back to gene ENSMUSG00000025903


For any suggestions or comments, please send an email to unitrap@crg.es