Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST215554
Clone ID OST215554
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST215554
Sequence
GGCTGCACTGCCCTTGTGGTAGCTTGTGGTTGCCNCGANNGCTTCGANCTCAGCNNNGCAGAGACGCTTTGTGCACANCC
TTCNTGAGGGACACNTCAGCCTCANCAAANGGATCANGAATGCCTGCCNGCCNATGGNTCTGNNNGNACCGNNGTTTTNC
TATANANCTATCANNCTGCTAAAGANTGCTTGACCATGCCAAAGTCAGGAAACACCAGAGGAAGTTCCTCCAAGCTATCC
ACCAACTGCGGGGTGTCAAGATGGAACAAAGGAAGCTGAGTGACCAAGCCAACACCCTGGTGGACCTTTCCAAGATGCAN
AACGTCATGTATGACTTAATCACGGAGCTCAATGACCGGAGTGAAGATCTAGAAAAGCAGATTGGCAGCCTGGAGTCCAA
GCTGGAGCACCTCACAGCCAGTTTCAATTCCCTGCCCCTGCTCATNGNAAAATACCCNTGCGCCANCANCANCANNAAGC
TGGTTCACTGCCTTTGGGGGA
Sequence Type mRNA
Unitrap ID UNI24552

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 89455946..89471187 150
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000794 (Kcnn3) NM_080466 potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3 Gene [Source:MGI (curated);Acc:Kcnn3-001]

 
Come back to gene ENSMUSG00000000794


For any suggestions or comments, please send an email to unitrap@crg.es