Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST215503
Clone ID OST215503
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST215503
Sequence
AGACTGAGATTCCATGAGGNCAGCTGACAAGGCACCTGAATGGCCTCATTTTAGCTATTTCTGTGTGTGGAGCTATTGCT
TGCTCCTTCAGTTCTGATCCCTGGNGCGACAGTGGCTCCTGAGCACCATGAAAGTTGTCCCANAGAAGAATGCTGTACGA
ATCCTCTGGGGCCGAGAACGGGGCACCTCGTGCCATGGGTGCCCAGCGGCTTCTGCAGGAGCTGGTGGAGGATAAGACTC
GATGGATGAAATGGGAGGGCAAGAGAGTAGAACTGCCTGATAGTCCACGCTCNACCTTCTTACTGGCCTTCAGCCCAAAC
AGGACTCTCTTGGCATCCACACATGTGAACCATAACATCTATATTACAGAGGTTAAGACTGGCAAGTGT
Sequence Type mRNA
Unitrap ID UNI24554

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91606599..91607913 241
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040506 (Ambra1) NM_172669 autophagy/beclin 1 regulator 1 Gene [Source:MGI (curated);Acc:Ambra1-001]

 
Come back to gene ENSMUSG00000040506


For any suggestions or comments, please send an email to unitrap@crg.es