Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST215364
Clone ID OST215364
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST215364
Sequence
GACTGAGCCCTTATAGCCTCATGGCGACTTCNTCANAGANGTGTTGCTGNTTGTGANGATGGTTCGTCAGANGANGCAGG
ATGGAGCACTGTACCTCNTGGCAGAGAGAATTGCTTGGGCACCTGAAGGCAAAGACAGATTTACAATCAGCCATATGTAT
GCAGATATTAAATGCCAGAAAANCAGNCCAGAGGGAAANGCTAAAATNCAACTTCAGCTGGTCCTGCATGCAGGGGACAC
AACAAACTTCCATTTTTCCAACNGAAAGCACTGGCAAGTGAAAGAACNGGNATGCAGTGAAGGACCTCCTTCANCAGCTT
GCTGCCCAAGTTCAAGCGGAAAGCTAATAAAGAGCTGGAGGAGAAGAACAGAATGCTCCAAGAAGATCCTGTTTTATTCC
AACTCTATAAAGACCTTGTTGTGAGCCAAGTGATCAGNGCTGAGGAATTCTGGGCCAATCGTTTAAATGNGAATGCAACA
GATAGTTCTACATCCAGTCACAAGCAGGGATGTTGGTTTTTNTGCAGCATTTTCTGGGCTGGATG
Sequence Type mRNA
Unitrap ID UNI24556

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 54057044..54060494 166
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006599 (Gtf2h1) NM_008186 general transcription factor II H, polypeptide 1 Gene [Source:MGI (curated);Acc:Gtf2h1-001]

 
Come back to gene ENSMUSG00000006599


For any suggestions or comments, please send an email to unitrap@crg.es