Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST215179
Clone ID OST215179
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST215179
Sequence
GACTGAGGTTTTTCTGTCCTTTTGTCCTCGTTTATGTACGAANGCTGCCAGCGGGCCATAGANACATGACCACCAATACG
GTCCCCTTGCACCCGTACTGGCCCAGGCACCTGAAGCTGGACAACTTCGTGCCTAATGACCTCCCGACTTCCCATATCNT
GGATTGGCCTGTTTTCCATCTCTGGGGGCCTAATTGTGATCACNGTGGCTGTTGTCTAGCCGAGCTTCCGTCGTCCCACT
TGGAGCTGGGCGGCGACTGGCCTTGTGCTGGTTTGCTGTGTGTACCTTCATTCACCTTGTGATCGAGGGCTGGTTCTCTC
TCTACAATGGCATCCTTTTAGAAGACCAAGCCTTCTTATCCCAACTCTGGAAAGAGTATTCCAAGGGAGATAGCCGATAT
ATCCTTANTGACAGCTTCNTCNNCTGTATGGAGACTGTCACAGNTTGTCTNTGGGGACCACTNAGCCTATGGGGNGNGAT
NGGCTTTTTTCGGCAACAGGNCCTTCCGNTTTGGCCTACAGGCTTGGGGGGG
Sequence Type mRNA
Unitrap ID UNI14249

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7763779..7767564 340
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031168 (Ebp) NM_007898 phenylalkylamine Ca2+ antagonist (emopamil) binding protein Gene [Source:MGI (curated);Acc:Ebp-001]

 
Come back to gene ENSMUSG00000031168


For any suggestions or comments, please send an email to unitrap@crg.es