Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST214900
Clone ID OST214900
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST214900
Sequence
TAGTGGTGAGTCGAGTGGTGGGCCACGCCAGGNAGTTGGAGAGAAGGCCATTAATGACGCCCTAAGNAAGCCCAAGNAAT
CAGGAGCACAGGGTGGTGAAGGAGGTCACTGAGAAGGTCACCCACACCATCACTGATGCTGTTACCCATGCGGCAGAAGG
CCTGGGAAGACTGGGACAGTGAGCCTGCCTACCAGCATGGCTGGCCCTTCCTGAAGGTCAATAAAGAGTGTGAAACGTGA
AAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI12993

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35165071..35166929 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043681 (2200001I15Rik) NM_183278 RIKEN cDNA 2200001I15 gene Gene [Source:MGI Symbol;Acc:MGI:1916384]

 
Come back to gene ENSMUSG00000043681


For any suggestions or comments, please send an email to unitrap@crg.es