Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST214689
Clone ID OST214689
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST214689
Sequence
CAAAAAGAAGAAGGCTTACCCCANTTACNGAAGCAGACCNTGTGGGGCNTCCGGAGAAATNGCTTGTAGCATGGTTTCTC
GTGTTGGCAGCAGATGGTACCTACNTGAGCAATGTCTACAGACCCAGCCGTAGAGTGTGTACCTGTGGGGATTTCCGGAG
GTTCCAATCTCGGAGACCCTTTGTGCAGCNGTGTATACCAGCCCTTACCCTCACCACTTTGCCGACGGACACAGAGCCTG
CAGCACCTACCGAACCATCTACCGGACTGCCTATCGCCGTAGCCCTGGGGTGACTCCCGCAAGGCCTCGCTATGCTTGCT
GCCCTGGTTGGAAGAAGGACCAGTGGGCTCCCTGGGGCTTGTGGAGCAGCAATATGCCAGCCTCCATGTGGGAATGGAGG
GAGTTGCATCCGCCCAGGACACTGCCGCTGCCCTGTGGGATGGCAGGGAGATACTTGCCAGACAGATGTTGATGAATGCA
GTACAGGAGAGGCCAGTTGTCCCCAGCGCTGTGTCAATACTGNGGGAAGTTACTGGTGCCAGGGATGGGAGGGACAAAGC
CCATC
Sequence Type mRNA
Unitrap ID UNI24570

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 26444569..26446518 116
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026921 (Egfl7) NM_198725 EGF-like domain 7 Gene [Source:MGI (curated);Acc:Egfl7-001]

 
Come back to gene ENSMUSG00000026921


For any suggestions or comments, please send an email to unitrap@crg.es