Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST214658
Clone ID OST214658
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST214658
Sequence
GACTGAGCTCCGCGTGAGTCGGCGTGAGGCAGAAGCGGAGCCCCGGCGGGTGCGATGGCCGCGGTGGTGGCCAAGCGGGA
AGGGCCGCCGTTCATCAGCGAGGCAGCCGTGCGAGGCAACGCCGCGGTCCTGGATTACTGCCGGACCTCAGTGTCAGCGC
TGTCCGGGGCCACCGCCGGCATCCTCGGCCTCACCGGCCTCTACGGCTTCATCTTCTACCTGCTTGCCTCCGTCCTGCTC
TCCCTGCTCCTCATTCTCAAAGCGGGAAGGAGGTGGAACAAATATTTTAAGTCACGAAGACCTCTCTTTACGGGAGGCCT
CATTGGAGGCCTCTTCACCTACGTCCTCTTTTGGACCTTCCTCTATGGCATGGGNGCACGTCTACTGAAATGAGGGCAGG
GGGTGACTTTAAAACAGATCGGCAAGGCTCTTGCCAGAATTAACACCCGGGTAGACTTACTTAAAATTTTAAATTGTTGG
AATTCGCTGNTTGNTCTGGACTGNTATAAATTTATATCTGAAGACAGANCCTGTAATATTATTCTTCAAA
Sequence Type mRNA
Unitrap ID UNI24316

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 72989717..72990255 506
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047260 (Tmem93) NM_025318 transmembrane protein 93 Gene [Source:MGI (curated);Acc:Tmem93-001]

 
Come back to gene ENSMUSG00000047260


For any suggestions or comments, please send an email to unitrap@crg.es