Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST214220
Clone ID OST214220
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST214220
Sequence
TTCAACTGGTGCCCAACGTGTGGCTTGAGTACCAAGGCTACAGTTNAGAACACTGCAGTGTTTCTGTTCGGCCGATTTTG
TGTGGAAGATGCCCTGCGTGGGAGCCTGCCGCCTCAACTAGAGATCCTGGACAGCTGTGGAGCTCAAGCGGCACCCAGTG
TGACAGTGAAGCCACCACTGACCCGGAGAACCCCTGTCACATGGACGGCCAACACTGCCTGTAGCCACTGCTATACTGCN
TGGACTCCATCCGCTGACACCTGCCATCATTCACCACGTGGATTGTCAGTGCTGCTGCAGGCCATGGCTGCTGCGGCCAC
GATTGCTATGAGACTCACAGACTT
Sequence Type mRNA
Unitrap ID UNI21635

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97800163..97806287 209
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052075 (1700029F12Rik) NM_025585 RIKEN cDNA 1700029F12 gene Gene [Source:MGI Symbol;Acc:MGI:1913729]

 
Come back to gene ENSMUSG00000052075


For any suggestions or comments, please send an email to unitrap@crg.es