Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSG040
Clone ID CSG040
Vector pGT0Lxf
Project baygenomics

Sequence tag CSG040
Sequence
AATGGCAGTGTGTGTGTTTGGAATCATGAAACTCAGACACTGGTGAAGACGTTTGAAGTATGTGATCTTCCTGTTCGAGC
TGCAAAGTTTGTCGCAAGGAAGAACTGGGTGGTGACAGGAGCAGACGATATGCAGATCAGAGTGTTCAATTATAACACCC
TGGAGAGGGTGCATATGTTTGAAGCACACTCGGATTACATTCGTTGTATTGCTGTTCATCCCACCCAGCCGTTCATTCTC
ACCAGCAGTGATGACATGCTTATTAAGCTCTGGGACTGGGATAAAAAATGGTCTTGTTCACAAGTGTTTGAAGGACACAC
GCACTACGTTATGCAGATTGTGATAAACCCCAAAGATAACAATCAGTTTGCCAGTGCATCTCTCGACAGGACCATCAAGG
TGTGGCAGCTGGGCTCCTCATCACCAAACTTCACTCTGGAAGGACATGAAAAAGGCGTGAATTGCATTGACTACTACAGT
GGTGGTGACAAGCCATACCTCATTTCAGGTGCAGATGACCGGCTTGTTAAAATATGGGATTATCAGAACAAAACGTGTGT
GCAGACCCTGGAGGGGCATGCCCAGAATGTGTCGTGTGCGAGCTTCCATCCTGAGCTGCCCATCATCATCACAGGGTCAG
AAGAC
Sequence Type mRNA
Unitrap ID UNI6150

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 98468514..98474583 152
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032458 (Copb2) NM_015827 coatomer protein complex, subunit beta 2 (beta prime) Gene [Source:MGI Symbol;Acc:MGI:1354962]

 
Come back to gene ENSMUSG00000032458


For any suggestions or comments, please send an email to unitrap@crg.es