Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSG043
Clone ID CSG043
Vector pGT0Lxf
Project baygenomics

Sequence tag CSG043
Sequence
AGTTGAGGTTGGAGCTATGGCGGCTGCGGCAGCTGTGGGGCCTGGCCTAGGGTCCGGGCCTGGAGACTCCCCAGAAGGTC
CCGAGGCGGACGCTCCGGAGCGTCGGCGGAAGGCTCACGGGATGCTGAAGCTTTACTACGGCCTCTCGGAGGGGGAGGTG
GCGGGGCATCCCGCAGGGCCTGACCCTCTGGACCCAACCGATCTCAATGGGGCGCACTTCGACCCGGAAGTTTATCTTGA
CAAGCTGCGTAGAGAATGTCCTCTGGCCCAGCTGATGGACAGTGAGACGGACATGGTACGGCAGATCCGGGCTCTAGACA
GCGACATGCAGACCCTGGTCTATGAGAACTACAACAAGTTCATCTCAGCTACAGACACCATTCGAAAGATGAAGAATGAC
TTCCGGAAGATGGAAGATGAGATGGACCGGCTGGCCACCAACATGGCAGTGATCACCAACTTCAGCGCACGGATCAGCGC
CACGCTACAGGACCGACACGAGCGCATCACCAAGCTAG
Sequence Type mRNA
Unitrap ID UNI6149

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 6071565..6077194 246
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024797 (1110014N23Rik) NM_001081041 RIKEN cDNA 1110014N23 gene Gene [Source:MGI Symbol;Acc:MGI:1915755]

 
Come back to gene ENSMUSG00000024797


For any suggestions or comments, please send an email to unitrap@crg.es