Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSG050
Clone ID CSG050
Vector pGT0Lxf
Project baygenomics

Sequence tag CSG050
Sequence
GAGACACACATGGGGGAGAGACAGGGATGGCCAAGGCACCAGGAAATGTCTGGAACCTGGAACACATCCAGAGAAAATGA
AGTTTGCCACACCTACGTGGCCATATGTGGCTCACAAAATGGCAGGGTTTTTATAAAGGATATTTATGTTGGCCTTTGGA
TCCACTGGTGTCTTCTATCTTTTTATTCATAAAGAATATTTGTATGCATTGTCTATTTGAATGAGGTGTTGTCATACTTC
ATATTTAAAGACTAAATTAGGTTTCTTTCCATTCACTATCGGCTGCAGGGTATTGTGTCACTCTGTTTGCTGTTTGAAAC
TCTTCTTCAAACGTATCTTCCCCAACTCTTTTATCATCTGCGAGAAATTGGAGCTCAACC
Sequence Type mRNA
Unitrap ID UNI6152

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 54280267..54280646 354
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039178 (Tbc1d19) NM_144517 TBC1 domain family, member 19 Gene [Source:MGI Symbol;Acc:MGI:1914499]

 
Come back to gene ENSMUSG00000039178


For any suggestions or comments, please send an email to unitrap@crg.es