Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSG067
Clone ID CSG067
Vector pGT0Lxf
Project baygenomics

Sequence tag CSG067
Sequence
AGCTACGCGGCGGCGCAGCACAGGCCTCGTGCGGTAACGGCATCCGGGCAGCCGCGGTGGCGTCCCGGTGCGGTCCTCAG
GTGACTGGAGCCGAGGGCTCGGCGGAGGGAAGTGTTGACGCTGCTGAAAGATGGCTGAAGAAGTGGTGGTGGTGGCCAAA
TTTGATTATGTGGCACAGCAGGAACAAGAGCTGGATATCAAGAAGAATGAGCGATTATGGCTCCTGGATGACTCTAAATC
Sequence Type mRNA
Unitrap ID UNI6055

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 100408964..100446525 130
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032475 (Nck1) NM_010878 non-catalytic region of tyrosine kinase adaptor protein 1 Gene [Source:MGI (curated);Acc:Nck1-001]

 
Come back to gene ENSMUSG00000032475


For any suggestions or comments, please send an email to unitrap@crg.es