Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSG072
Clone ID CSG072
Vector pGT0Lxf
Project baygenomics

Sequence tag CSG072
Sequence
TAAGAAATTGAGAAAAGCAAGTGAAGGCTTGAATTGTACACATGAAGATCACATCATGTCCCATCCAGCATTGCATGATG
CCCTTAATGACCCAAGGAATGGCGATGGTGCAGTCAAACACCTGAAACAGCCGGCTTCTATTCTAGGCAACATTGAAAAG
TTAAAGTTACTTGGCCCAAGAAGATGATTTGATGAGTTTGGAGCAGGAAAGGGGAAATTATCTCACTGGGTTGATACTGC
CATAAAAGATGGTGAAAATGTTCACTTCATCCTGGTAGAAAGAGTGACCACAAGATTCAAGGTAGATGGTAAACACAGAA
AAAAGGACTCA
Sequence Type mRNA
Unitrap ID UNI5097

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 116288716..116292677 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033439 (Ccdc76) NM_030016 coiled-coil domain containing 76 Gene [Source:MGI Symbol;Acc:MGI:1925219]

 
Come back to gene ENSMUSG00000033439


For any suggestions or comments, please send an email to unitrap@crg.es