Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST213820
Clone ID OST213820
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST213820
Sequence
TCTCAAGCAAGCTCACAACTTCACACATGGGATTTATGTCACCTATGATGACGGGCANGGTGAACTTCACTCACGGATGA
AGTGGGGCTTTGCTGGATCCTTCTCACGAACNAGTCTCTACAAGGGTGTGGTGATGNCTACGAGACCTATACGGAATCTC
ACANGCCTATAGGGTTACATTTGGGGAAGAACATACCGATNGGAGACCATTTTCAAACCTTCT
Sequence Type mRNA
Unitrap ID UNI24596

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 175544889..175550421 80
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078893 (BX890623.7-202) Novel KRAB box and zinc finger, C2H2 type domain containing protein [Source:UniProtKB/TrEMBL;Acc:A2ARL5]

 
Come back to gene ENSMUSG00000078893


For any suggestions or comments, please send an email to unitrap@crg.es