Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSG077
Clone ID CSG077
Vector pGT0Lxf
Project baygenomics

Sequence tag CSG077
Sequence
GTCCAGTATACCTTTCCCAGTACCCGACACCAGCAGGAATTTGCAGTTCCTGACTACCGCTCTTCTCATATTGAAGTTAG
CCAGGCATCACAGCTTTTACAGCAGCAGCAGCAGCAGCAGCAGCTTCGAAGACGACCTTCCTTGCTTTCAGAATTTCACC
CGGGTTCTGACAGGCCTCAAGAAAGGAGAACTGGATATGAACAGTTTCACTCAGGACCCTCACCAGGTGGATCATGATTC
CTTGGAGTCCAAGCGCCCACGCCTGGAGCCAGTTTCTGATGCCCATTTCCAGCGTGTTAGTGCTGCGGTTTTACCTTTAG
TTCACTCGCTGCCAGAAGGCTTGAGGTCGTCTGCAGATGCTAAGAAGGATTCAGCATTTGGAAGCAAACATGAAGCTCCA
TCCTCTCCTTTGGCTGGGCAACCATGTGGAGATGACCAAAATGCTTCACCTTCAAAGCTTTCAAAGGAGGAGTTAATACA
GAGTATGG
Sequence Type mRNA
Unitrap ID UNI4769

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62233162..62251875 193
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018501 (Ncor1) NP_035438 nuclear receptor co-repressor 1 Gene [Source:MGI (curated);Acc:Ncor1-001]

 
Come back to gene ENSMUSG00000018501


For any suggestions or comments, please send an email to unitrap@crg.es