Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST213655
Clone ID OST213655
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST213655
Sequence
TGTCTTCAACCTGTGCGGCNGGTAAANTTTGACTACCTGGAGNTGGCTTCTCCNACAGACTAGCTGCTGAAGANCATNGT
GCTACCTGNACCTGNAANATATTGNCAGCCTCTCCCANACATCAAGCAAGTTTGANAAGTTGTGCAAGAGNGACTTGCTG
TGGGAACAGATAGTCCAGTCCACCTGTGACACCATCACCCCTGACATGCGGGCCTTGGCGAAAAACATGGGCTGGAGGCA
GATGTTCCTCACCAACAACATCCAGCTCCAGAGGCAGACCCGCAAGAAGAAGCAAAGACAGGAAAACCAGGCAGAGAAGC
TTGCTTAGGGGATGGCTGTTTCCAACAGCGGAGCCACAGTGGTCCGAATCTCCAGGTCCAAAGCTCACTCTCTCTTAAC
Sequence Type mRNA
Unitrap ID UNI19123

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84893105..84896831 260
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]

 
Come back to gene ENSMUSG00000073633


For any suggestions or comments, please send an email to unitrap@crg.es