Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSG104
Clone ID CSG104
Vector pGT0Lxf
Project baygenomics

Sequence tag CSG104
Sequence
GGGGCGCGACCCGCGCCGCCGGCTTGCCCGATTTCCGCGGGTCGGTCCTGTCGGTGCCGGTCGTGGGTTCCCGTGTCGTT
CCCGTGTTTTTCCGCTCCCGACCCTTTTTTTTTCCCCCCCACACGTGTCTCGTTTCGTTCCTCGCTGGCCGGCCTGAGGC
TACCCCTCGGTCCGTGGAGCGGGCAATACTGAGCTGATGAGCAATTTCGCCGCGGTGGATGAGTCGCCTTTGCTGAACTC
CAGGGCTGTCCTTGGCCAGAGGCTTCGAGGCCCAGATGGAGATTGTCTTTTATTCAGGGACTCGCTTCATGACGGCGAGC
GTTCAGATCTCAGGGCCTTGCATGTGAAGCCAGGAGCCGATAGGGTTAGGATCTCAAGCAACGAAATCAGGTCTGACAGT
CCCTATTCTGTCCACTTCCAGGAATCTGTGGGCTCCTGTGGCCGACACACATGAGGGTCATATCACCAGCGATATGCAGC
TTTCTACCTACTCAGACCCTGCCCTGGAGCTGGGTCCCCGTAATGTACTGCTGTTCCTACAGGACA
Sequence Type mRNA
Unitrap ID UNI6158

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 71542748..71543086 337
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019087 (Atp6ap1) NM_018794 ATPase, H+ transporting, lysosomal accessory protein 1 Gene [Source:MGI (curated);Acc:Atp6ap1-001]

 
Come back to gene ENSMUSG00000019087


For any suggestions or comments, please send an email to unitrap@crg.es