Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST212738
Clone ID OST212738
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST212738
Sequence
ACCACAGGTCAGTTTGCAAATTGAGCGAGGATCTCAGGACTGAGCAAAATGGAAACCTTGACATTCTGGGNAAGGATTCC
TAGCAGCATGAATCCTATTGACAATGTGAGCTCCTCTGAGTGTCTGTGAAATACTTCCAGTGTTCCTCATCATGTTTCCA
GCAAGTCCCTTTTTCTACGTTGCNGTTTGTTTAATGTATGTTAATTTCACCTGGCTTCATTCATTTTCCTTTTTAAAATT
TGTCTTTTAAATAAACAAACAGAACCCTCTGNGANGATGGTGAGAGTAAAAAA
Sequence Type mRNA
Unitrap ID UNI10744

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114292371..114292652 253
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031954 (Cfdp1) NM_011801 craniofacial development protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344403]

 
Come back to gene ENSMUSG00000031954


For any suggestions or comments, please send an email to unitrap@crg.es