Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST212518
Clone ID OST212518
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST212518
Sequence
GACTGAGTGCACTGTCCAGGTGAAGTTAGAGCTGGGGCACCGTGCCCAGCTACGGAGAAGCCCACCACCGAGGGCTTCAC
CCATGACTGGATGGTCTTCGTGCGTGGCCCTGAGCAGTGTGACATCCAGCACTTTGTGGAGAAGGTCATCTTCCGGCTGC
ATGACAGCTTCCCTAAACCCAAGCGTGGGGA
Sequence Type mRNA
Unitrap ID UNI14537

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 57066411..57066600 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024212 (Mllt1) NM_022328 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1 Gene [Source:MGI Symbol;Acc:MGI:1927238]

 
Come back to gene ENSMUSG00000024212


For any suggestions or comments, please send an email to unitrap@crg.es